View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_74 (Length: 235)
Name: NF9711_low_74
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 45 - 218
Target Start/End: Original strand, 36925043 - 36925216
Alignment:
| Q |
45 |
gatgaaggccaaataaacacaccctgtgtttctgaagtgattgcagataactttgttgcaaaggccctttctgacctggaagagtctttcaggatgcctc |
144 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36925043 |
gatgaaggccaaataaccacactttgtgtttctgaagtgactgcagataacttagttgcaaaggccctttctgacctggaagagtctttgaggatgcctc |
36925142 |
T |
 |
| Q |
145 |
tgaaggacatagctagctcagaggctaacagcctttgccttctaacggcgcttaacttcttgtcccacctttct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36925143 |
tgaaggacatagctagctcagaggctaacagcctttgccttctaacggcgcttaacttcttgtcccacctttct |
36925216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University