View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9711_low_76 (Length: 231)

Name: NF9711_low_76
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9711_low_76
NF9711_low_76
[»] chr1 (1 HSPs)
chr1 (13-214)||(3456606-3456807)
[»] chr3 (1 HSPs)
chr3 (163-214)||(48694156-48694207)


Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 3456807 - 3456606
Alignment:
13 caaaggaaggaagttgagcaaagaaaattggagatacttaaagagaataatcgattcgaggaagagattagttatggcggagacaaacgtccggtttcaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3456807 caaaggaaggaagttgagcaaagaaaattggagatacttaaagagaataatcgattcgaggaagagattagttatggcggagacaaacgtccggtttcaa 3456708  T
113 tattggacgatgcttactatacttggcaagatctaccggcggcgataaggaaaagtaatgttgttgttcaaaacaagagaattgaaattgaggctgagta 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||    
3456707 tattggacgatgcttactatacttggcaagatctaccggcggcgataaggaaaagtgatattgttgttcagaacaagagaattgaaattgaggctgagta 3456608  T
213 tg 214  Q
    ||    
3456607 tg 3456606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 214
Target Start/End: Original strand, 48694156 - 48694207
Alignment:
163 aaaagtaatgttgttgttcaaaacaagagaattgaaattgaggctgagtatg 214  Q
    ||||||||||||||||| ||||| |||||| |||||||||| || |||||||    
48694156 aaaagtaatgttgttgtacaaaataagagagttgaaattgatgccgagtatg 48694207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University