View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_80 (Length: 228)
Name: NF9711_low_80
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_80 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 2625907 - 2625697
Alignment:
| Q |
1 |
ttacaatagaaacttagtttgtactaatttattgttttaagcatgttgtacgctatttatctttattccttttttactatggttaatgaatgccaactgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625907 |
ttacaatagaaacttagtttgtactaatttattgttttaagcatgttgtacgctatttatctttattccttttttactatggttaatgaatgccaactgc |
2625808 |
T |
|
| Q |
101 |
tttatttaatatcatgcaagtactcaaaaacttctagttttcaaagttaccaaacaaactgtggaaataatactttaatttactaagaatttcgaaagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625807 |
tttatttaatatcatgcaagtactcaaaaacttctagttttcaaagttaccaaacaaaccgtggaaataatactttaatttactaagaatttcgaaagtt |
2625708 |
T |
|
| Q |
201 |
catccatgatt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
2625707 |
catccatgatt |
2625697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 121 - 159
Target Start/End: Complemental strand, 765562 - 765524
Alignment:
| Q |
121 |
tactcaaaaacttctagttttcaaagttaccaaacaaac |
159 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
765562 |
tactcaaaaacttccagttttcaaagttaccaaacaaac |
765524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University