View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9711_low_88 (Length: 220)

Name: NF9711_low_88
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9711_low_88
NF9711_low_88
[»] chr1 (2 HSPs)
chr1 (144-206)||(4116235-4116297)
chr1 (19-80)||(4116114-4116175)


Alignment Details
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 144 - 206
Target Start/End: Original strand, 4116235 - 4116297
Alignment:
144 gctgccttaatctccatatccttcttaagcacaattcatatttccctcatggcctatctctgc 206  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
4116235 gctgccttaatctccatatccttcttaagcacaatttatatttccctcatggcctatctctgc 4116297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 4116114 - 4116175
Alignment:
19 aaattgacacgttgaattagacttatttaccaaatttggtggataagctcaatgttctgcat 80  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
4116114 aaattgacacattgaattagacttatttaccaaatttggtggataagctcaatgttctgcat 4116175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University