View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_89 (Length: 218)
Name: NF9711_low_89
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_89 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 13 - 192
Target Start/End: Original strand, 28515873 - 28516047
Alignment:
| Q |
13 |
cggacgttggggtttaaggtgggacgtagtgcaaaggtttttagttcaaaaaatgtaatgtttcggaaatgaaaatcggccaccacagcacatattaaaa |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28515873 |
cggacattggggtttaaggtgggacgtagtgcaaaggtttttagttcaaaaaatgtaatgtttcggaaatgaaaatcggccac-----cacatattaaaa |
28515967 |
T |
 |
| Q |
113 |
tacatttttcttttattatttaaaattcacacaaattcattaaatcttgtaaatttcgtttaaatttggtgggacccaca |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
28515968 |
tacatttttcttttattatttaaaattcacgcaaattcactaaatcttctaaatttggtttaaatttggtgggactcaca |
28516047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University