View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_90 (Length: 218)
Name: NF9711_low_90
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_90 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 31773552 - 31773364
Alignment:
| Q |
17 |
gtgttttcatctatttataaaaatccaaattattttgcctcttcaacatgacttgatactgacagtgaagatagacctgaatagtgattttaaactctga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31773552 |
gtgttttcatctatttataaaaatccaaattattttgcctcttcaacatgactcgatactgacggtgaagatagatctgaatagtgaatttaaactctga |
31773453 |
T |
 |
| Q |
117 |
agaaaaatcgacaaataattttaaattcaaagtaggaatggaattctcgtatacgaaactattcaaggatgttgtacttgtacataatg |
205 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31773452 |
agaagaatcgacaaataattttaaattcaaagtaggaatgaaattctcgtacacgaaactattcaaggatgttgtacttgtacataatg |
31773364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University