View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_92 (Length: 216)
Name: NF9711_low_92
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_92 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 16 - 134
Target Start/End: Original strand, 28311263 - 28311381
Alignment:
| Q |
16 |
catacatctctttctcgaccttgtttaataaattttttctaaaactaccttacctttgagacatgtgtaatctatgatagaaactttccggttcatgttc |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28311263 |
catacttctctttctcgaccttgtttaataaattttttctaaaactaccttacctttgagacatgtgtaatctatgatagaaactttccggttcatgttc |
28311362 |
T |
|
| Q |
116 |
cttaattacatcatgtgtt |
134 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
28311363 |
cttaattgcatcatgtgtt |
28311381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 28306472 - 28306522
Alignment:
| Q |
16 |
catacatctctttctcgaccttgtttaataaattttttctaaaactacctt |
66 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
28306472 |
catacatctctttatcgaccttttttaataaacttgttctaaaactacctt |
28306522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University