View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9711_low_94 (Length: 212)
Name: NF9711_low_94
Description: NF9711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9711_low_94 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 115 - 194
Target Start/End: Original strand, 43315951 - 43316030
Alignment:
| Q |
115 |
tgttcggatctcttgttttttcaattttagaattatacatagaagtgtccgacattggcgccttcttaatccattcgttg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43315951 |
tgttcggatctcttgttttttcaattttagaattatacatagaagtgtccgacattggcgccttcttaatccattcgttg |
43316030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 15 - 72
Target Start/End: Original strand, 43315897 - 43315954
Alignment:
| Q |
15 |
caaaggagggcaaaaatcttaccttcgaaatgttggtattctcagttttttgattgtt |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43315897 |
caaaggagggcaaaaatcttaccttcgaaatgttggtattctcagttttttaattgtt |
43315954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University