View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9712_low_11 (Length: 381)
Name: NF9712_low_11
Description: NF9712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9712_low_11 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 39 - 381
Target Start/End: Complemental strand, 49584993 - 49584655
Alignment:
| Q |
39 |
ttcaacaaaagcataaaggtcttttaatatgtgtccttacatgaacatatgctgctaagtagatactgacagtcatattcaatctctcattataagacat |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584993 |
ttcaacaaaagcataaaggtcttttaatatgtgtccttacatgaacatatgctgctaagtagatactgacagtcatattcaatctctcattataagacat |
49584894 |
T |
|
| Q |
139 |
cattgtttgaagcctccgttactgctagcaatgccattaccggccgttggagacaacctttgctccttcctcattttcagaacctgcaacaccaccacta |
238 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584893 |
cattgtttgaagccttcgttactgctagcaatgccattaccg----ttggagacaacctttgctccttcctcattttcagaacctgcaacaccaccacta |
49584798 |
T |
|
| Q |
239 |
ccagaaccttccactttacgacacacatgtcgtgaaggttttgatactaaacagtcctcctgacttctgttgcgcttctttttgtctagatatccaaatg |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584797 |
ccagaaccttccactttacgacacacatgtcgtgaaggttttgatactaaacagtcctcctgacttctgttgcgcttctttttgtctagatatccaaatg |
49584698 |
T |
|
| Q |
339 |
cgaaagcctccggaactttctcccgaggtggaattaccgttgc |
381 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584697 |
caaaagcctccggaactttctcccgaggtggaattaccgttgc |
49584655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 11 - 47
Target Start/End: Complemental strand, 49585215 - 49585179
Alignment:
| Q |
11 |
caaaggtccttgcttggacaaacacacattcaacaaa |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49585215 |
caaaggtccttgcttggacaaacacacattcaacaaa |
49585179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University