View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9712_low_18 (Length: 269)
Name: NF9712_low_18
Description: NF9712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9712_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 258
Target Start/End: Complemental strand, 11983103 - 11982861
Alignment:
| Q |
16 |
actttgtcaccagaaattgcacgatgaggcatctttacatctatcattcgataatgtccagattgcttcattcaataaggagtcaaatgtcctcgacgtt |
115 |
Q |
| |
|
|||||||||| | ||||||||| ||||| | || ||| |||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
11983103 |
actttgtcactataaattgcactatgagacgtcgttatatctatcattcgataatgtccagattgcttcattcaatgaggtgtcaaatgtcgtcgacgtt |
11983004 |
T |
|
| Q |
116 |
gccaatttttgcgatgactgtgatgagttttctagggccaaaaaattccttctatacaactcttctgcactaaagaagaggaaaagggtggcaatgatct |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11983003 |
gccaatttttgcgatgaccgtgatgagttttctagggccaaaaaattccttctatacaactcttctgcactaaagaagaggaaaagggtggcaatgatct |
11982904 |
T |
|
| Q |
216 |
tatcttcactaagtctgatcttattaattccaaacaatttcat |
258 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11982903 |
tatcttcactaagtctgatcttataaattccaaacaatttcat |
11982861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University