View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9712_low_21 (Length: 250)
Name: NF9712_low_21
Description: NF9712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9712_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 57 - 148
Target Start/End: Complemental strand, 31408576 - 31408492
Alignment:
| Q |
57 |
ataccatagttattgttactgcacattaattagtagtggccatctatgactttttggtgtgattcatttgaaatatgtcttattgtgtttta |
148 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
31408576 |
ataccataattattgttactgcacatta-------gtggccatctatgactttttggtgtgattcatttgatatatgtcttattatgtttta |
31408492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University