View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9712_low_23 (Length: 243)
Name: NF9712_low_23
Description: NF9712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9712_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 15 - 225
Target Start/End: Complemental strand, 34712377 - 34712171
Alignment:
| Q |
15 |
tctcaaaattaacatcatcctagaagtggttagaaaatgaaggttagtaggatgatgtaaacaaaaactgagttgaaactacaattaagctaaatgatcg |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34712377 |
tctcaaaattaacatcatcttagaagtggttagaaaatgaaggttagtaggatgatgtaaacaaaaactgagttgaaaccacaattaagctaaatgatcg |
34712278 |
T |
 |
| Q |
115 |
aatgaaatattctgtagaagtacaacatgtgatcaagatttagataacgggatgaaagttattaccataccataattcaaatctctctctccccat-ccc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
34712277 |
aatgaaatattctgtagaagtacaacatgtgatcaagatttagataacgggatgaaagttattac-----cataattcaaatctctctctccccatcccc |
34712183 |
T |
 |
| Q |
214 |
tcccctccctta |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34712182 |
tcccctccctta |
34712171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University