View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9712_low_28 (Length: 239)
Name: NF9712_low_28
Description: NF9712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9712_low_28 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 6440 - 6658
Alignment:
| Q |
1 |
taaaaccaaagagatgattctaaatttctaaccccaccccaccccacaacttcaaagaatgatagaaacatgtacaaaagatattcagaaaaactagata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6440 |
taaaaccaaagagatgattctaaatttctaaccc-----caccccacaatttcaaagaatgatagaaacatgtacaaaagatattcagaaaaactagata |
6534 |
T |
 |
| Q |
101 |
gggacaatatcggcatatcaattatcttgacaaaggttaaagctatacacactgaatcaataaatcacataattacccatattagaattagaaaaggcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6535 |
gggacaatatcggcatatcaattatcttgacaaaggttaaagccatacacactgaatcaataaatcacataattacccatattagaattagaaaaggcct |
6634 |
T |
 |
| Q |
201 |
ccattaaactcaaatgtattatgt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6635 |
ccattaaactcaaatgtattatgt |
6658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University