View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9712_low_31 (Length: 228)
Name: NF9712_low_31
Description: NF9712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9712_low_31 |
 | |
|
| [»] scaffold0036 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0036 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 6216 - 6443
Alignment:
| Q |
1 |
tacagcagcatatacaacggaacaagnnnnnnncagaacaaatatgacagatgaatataacaacatgcttacttaagacataccaaatccaatcaatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
6216 |
tacagcagcatatacaacggaacaagaaaaaaacagaacaaatatgacagatgaatataacaacatgcttacttacgacataccaaatccaatcaataaa |
6315 |
T |
|
| Q |
101 |
agagcttccttaaggcaatgtgatgcaccaattagcnnnnnnnnnnnnnnnntgtgatgcaccaaatcccaccttatccatattgttttagcatcagtaa |
200 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316 |
agtgcttccttatggcaatgtgatgcaccaattagctttttcaaaaaaaaaatgtgatgcaccaaatcccaccttatccatattgttttagcatcagtaa |
6415 |
T |
|
| Q |
201 |
cataaattgggcaatgcagccccttaaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6416 |
cataaattgggcaatgcagccccttaaa |
6443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University