View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9712_low_32 (Length: 224)
Name: NF9712_low_32
Description: NF9712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9712_low_32 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 46063514 - 46063293
Alignment:
| Q |
4 |
acacttactattaatctattcatttgatgaggatttttgttgagtatcaacaatcttactatgtttggattttggaatgtaagacttataaatgcttttt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46063514 |
acacttactattaatctattcatttgatgaggatttttgttgagtatcaacaatcttactatgtttggattttggaatgtaagacttataaatgcttttt |
46063415 |
T |
|
| Q |
104 |
caagaatcttgagcataaga-nnnnnnnnctccctttgtagttgtgcataggcaagggagctaattcatccttgtaaaactatttttacaatttgcttgc |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
46063414 |
caagaatcttgagcataagatttttttttctccctttgtagttgtgcataggcaagggagctaattcaacctttcaaaactatttttacaatttacttgc |
46063315 |
T |
|
| Q |
203 |
attcgcacttttctgaatgatt |
224 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
46063314 |
attcacacttttctgaatgatt |
46063293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University