View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9713_low_4 (Length: 349)
Name: NF9713_low_4
Description: NF9713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9713_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 18 - 334
Target Start/End: Original strand, 46909873 - 46910189
Alignment:
| Q |
18 |
atcacttcttaacaaattttaaaggggggcatttttgtcgcccagaatcctggtctcattctcactttgcatatatacctgacatgccatacannnnnnn |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46909873 |
atcacttcttaacaagttttaaaggggggcatttttgtcgcccagaatcctggtctcattctcactttgcatatatacctgacatgccatacattttttt |
46909972 |
T |
|
| Q |
118 |
ncatctaaatgaaaatctaataatttgtcacgctaccctactttggttaatgcattgtaagtgtaaaacagtattgcattgacagaaatgggagataatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46909973 |
tcatctaaatgaaaatctaataatttgtcacgctaccctactttggttaatgcattgtaagtgtaaaacagtattgcattgacagaaatgggagataatt |
46910072 |
T |
|
| Q |
218 |
gaaagcccggtaattcaatgaagcgcatgcactgaaacacttgaatagtaagaggatgagtgcatgcatactgcatacactattgagtcaaatttgaaac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46910073 |
gaaagcccggtaattcaatgaagcgcatgcactgaaacacttgaatagtaagaggatgagtgcatgcatactgcatacactattgagtcaaatttgaaac |
46910172 |
T |
|
| Q |
318 |
gatggacgggacgaatt |
334 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46910173 |
gatggacgggacgaatt |
46910189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University