View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9713_low_5 (Length: 274)
Name: NF9713_low_5
Description: NF9713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9713_low_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 14 - 274
Target Start/End: Original strand, 4243469 - 4243729
Alignment:
| Q |
14 |
caacaacaactggtaattatacggttaagtcggcataccgcatttgtagtgatctactccaccctcatgattctgcccacaataattcttcatggatgaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4243469 |
caacaacaactggtaattatacggttaagtcggcataccgcatttgtagtgatctactccaccctcatgattctgcccacaataattcttcatggatgaa |
4243568 |
T |
|
| Q |
114 |
tatctggtatctcaatattcctcaccgtgtccgagcctttctatggcgtttagctcatcattgcttgcccactcgtgtcaatcttaatgcaagaggaatt |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4243569 |
tatctggaatctcaatattcctcaccgtgtccgagcctttctatggcgtttagctcataattgcttgcccactcgtgtcaatcttaatgcaagaggaatc |
4243668 |
T |
|
| Q |
214 |
cagtgcgaggaatcatgtgttatgtgtgaacattttgcggaatgccacactcatctcttct |
274 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
4243669 |
cagtgcgaggaatcatgtgttatgtttgaaaattttgcggaatgccacactcatctcttct |
4243729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 55 - 274
Target Start/End: Complemental strand, 33496066 - 33495847
Alignment:
| Q |
55 |
atttgtagtgatctactccaccctcatgattctgcccacaataattcttcatggatgaatatctggtatctcaatattcctcaccgtgtccgagcctttc |
154 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
33496066 |
atttgtattgatctactccaccctcatgattctgcccacaataattctctttggatgaatatctggactctcgatattcctcaccgtgttcgagccttta |
33495967 |
T |
|
| Q |
155 |
tatggcgtttagctcatcattgcttgcccactcgtgtcaatcttaatgcaagaggaattcagtgcgaggaatcatgtgttatgtgtgaacattttgcgga |
254 |
Q |
| |
|
| |||| |||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
33495966 |
tgtggcatttagctcatcatttcttgcccacccgtgtcaatcttaatgtaagaggaattcagtgcgaggaatcatgcgttatgtgtgaaacttttgcgga |
33495867 |
T |
|
| Q |
255 |
atgccacactcatctcttct |
274 |
Q |
| |
|
|| ||||| | ||||||||| |
|
|
| T |
33495866 |
atcccacattaatctcttct |
33495847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University