View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9713_low_6 (Length: 266)
Name: NF9713_low_6
Description: NF9713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9713_low_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 27 - 266
Target Start/End: Original strand, 46462005 - 46462247
Alignment:
| Q |
27 |
cataggagcattgtttatgggacagagaacattgccattaacac---cttgagtttcagccccatattgctgaagctgagcagggctctgcaatatgaac |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46462005 |
cataggagcattgtttatgggacagagaacaatgccattaacactttcttgagtttcagccccatattgctgaagctgagcagggctctgcaatatgaac |
46462104 |
T |
|
| Q |
124 |
tggattctctctatttcttcttcttgcttccgcatttcttgagcctaaatttgttggaactatcatttttaaatttatactgagcaaataatttatgacc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46462105 |
tggattctctctatttcttcttcttgcttccgcatttcttgagcctaaatttgttggaactatcatttttaaatttatactgagcaaataatttatgacc |
46462204 |
T |
|
| Q |
224 |
tatggtacatactaaacaatagaaacaaagcttatgcatagat |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46462205 |
tatggtacatactaaacaatagaaacaaagcttatgcatagat |
46462247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University