View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9713_low_8 (Length: 261)
Name: NF9713_low_8
Description: NF9713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9713_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 33 - 213
Target Start/End: Complemental strand, 20153811 - 20153631
Alignment:
| Q |
33 |
gaatatcataatgtaaataaaggtgttaaaatcacatggctcatgagattggtttggtatagtctcacgtatacacagcaacgatgaccttgactttgaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20153811 |
gaatatcataatgtaaataaaggtgttaaaatcacatggctcatgagattggtttggtatagtctcacgtatacacagcaacgatgaccttgactttgaa |
20153712 |
T |
 |
| Q |
133 |
gagttcaaacgtgggcatgcattccacttgtaacattttggtttacttggtattccttttcacattccaagaacatttata |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20153711 |
gagttcaaacgtgggcatgcattccacttgttacattttggtttacttggtattccttttcacattccaagaacatttata |
20153631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 210 - 250
Target Start/End: Complemental strand, 20153548 - 20153508
Alignment:
| Q |
210 |
tatatatatattgcttgacttacagtagattacgcgttcat |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20153548 |
tatatatattttgcttgacttacagtagattacgcgttcat |
20153508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University