View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9713_low_9 (Length: 249)
Name: NF9713_low_9
Description: NF9713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9713_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 33886284 - 33886049
Alignment:
| Q |
1 |
caacttcaattgctatttggtactagtttagtagtagtagtaattttatatgaaaagtatcttttgttgtaacttcctttttagtgcacgtttccttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33886284 |
caacttcaattgctatttggtactagtttagtagtagtagtaattttatatgaaaagtatcttttgttgtaacttcctttttagtgcacgtttccttttt |
33886185 |
T |
 |
| Q |
101 |
ggctttccgcagcttcaattatctttatttatttatgtatggaatagaattttacctttttctcaactttaggctaatttggaatatcctcttgatccca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33886184 |
ggctttccgcagcttcaattatctttatttatttatgtatggaatagaattttacctttttctcaactttaggctaatttggaatatcctcttgatccca |
33886085 |
T |
 |
| Q |
201 |
agttatgatgccccaactcagtgtagggaccatgtg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33886084 |
agttatgatgccccaactcagtgtagggaccatgtg |
33886049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University