View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9714_low_2 (Length: 249)
Name: NF9714_low_2
Description: NF9714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9714_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 37835636 - 37835385
Alignment:
| Q |
1 |
atattctagattaatagaataacttatcaattattgttgcttcatgaaatttttaatttgtttttaactctttgtatttgacattgttataggaaactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37835636 |
atattctagattaatagaataacttatcaattattgttgcttcatgaaatttttaatttgtttttaactctttgtatttgacattgttataggaaactct |
37835537 |
T |
|
| Q |
101 |
cacacattgttttagtccattatctggaagaggaggtaatttaaggaggaatgaactaatgacatacttttgt-------atcaaatatgaaataagaaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
37835536 |
cacacattgttttagtccattatctggaagaggaggtaatttaaggaggaatgaactaatgacatacttttattgtaacaatcaaatatgaaataagaaa |
37835437 |
T |
|
| Q |
194 |
gtataaatattgtattccccgaaattaaacttcatagctttttcttctctct |
245 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37835436 |
gtataaatattgtattccccaaaattaaacttcatagctttttcttctctct |
37835385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 62 - 130
Target Start/End: Complemental strand, 37844486 - 37844418
Alignment:
| Q |
62 |
ttttaactctttgtatttgacattgttataggaaactctcacacattgttttagtccattatctggaag |
130 |
Q |
| |
|
|||| |||||||||||| |||||||||| ||| ||||||||||||| ||| |||||||||||| ||||| |
|
|
| T |
37844486 |
ttttcactctttgtattcgacattgttacagggaactctcacacatcgttctagtccattatcgggaag |
37844418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University