View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9715_low_5 (Length: 302)
Name: NF9715_low_5
Description: NF9715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9715_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 5 - 287
Target Start/End: Complemental strand, 30325758 - 30325476
Alignment:
| Q |
5 |
aaaggggtgaagagaagtgggttgagagtggcattatgggaagaacatggtagtagggttggtctttcatcaaaaacgtagttgccaaagtgaagttgtt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325758 |
aaaggggtgaagagaagtgggttgagagtggcattatgggaagaacatggtagtagggttggtctttcatcaaaaacgtagttgccaaagtgaagttgtt |
30325659 |
T |
|
| Q |
105 |
caatgtgtgatttaaatttgcgatactgaagaaaatgaaagtaggagtaacggcaaacaatgccgggtggtgggaagcgacagaggtcgccggggaagcg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325658 |
caatgtgtgatttaaatttgcgatactgaagaaaatgaaagtaggagtaacggcaaacaatgccgggtggtgggaagcgacagaggtcgccggggaagcg |
30325559 |
T |
|
| Q |
205 |
agtggtccatgggaaatctgggttgatggagttgagaacattgtagagtgctttttgttcagttggatgaatgggtggtttgt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||| |
|
|
| T |
30325558 |
agtggtccatgggaaatctgggttgatggagttgagaacattgtagagtgctttttgttcggttgggtgtatgggtggtttgt |
30325476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 121 - 287
Target Start/End: Complemental strand, 30337279 - 30337113
Alignment:
| Q |
121 |
tttgcgatactgaagaaaatgaaagtaggagtaacggcaaacaatgccgggtggtgggaagcgacagaggtcgccggggaagcgagtggtccatgggaaa |
220 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
30337279 |
tttgcgatacttaagaagatgaaagtaggagtaacggcaaacaacgccgggtgggggtaagcgacagaggtcgccggagaagcgagttgtccatgggaaa |
30337180 |
T |
|
| Q |
221 |
tctgggttgatggagttgagaacattgtagagtgctttttgttcagttggatgaatgggtggtttgt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
30337179 |
tctgggttgatggagttgagaacattgtagagtgctttttgttcagttgggtgtatgggtggtttgt |
30337113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 270
Target Start/End: Original strand, 30343383 - 30343430
Alignment:
| Q |
223 |
tgggttgatggagttgagaacattgtagagtgctttttgttcagttgg |
270 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30343383 |
tgggttgagggagttgagaacattgtagagtgctttttgttctgttgg |
30343430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University