View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9716_low_10 (Length: 348)
Name: NF9716_low_10
Description: NF9716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9716_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 19 - 337
Target Start/End: Complemental strand, 29517113 - 29516799
Alignment:
| Q |
19 |
cttttgcgtcaaatggactcttaggaagaaaactttgggattttagcaacaagttgatcaattcaatttcaaagtcttgatttgtcttgctcatccatca |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29517113 |
cttttgcgtcaaatggactattaggaagaaaactttgggattttagcaacaagttgatcaattcaatttcaaagtcttgatttgtcttgctcatccatca |
29517014 |
T |
 |
| Q |
119 |
ctctcgtcaaatcaattattagtagttatatatatgacttgtattatgtgcccctaaaatagaagccttcttcttttgtgtgtacttactttattgaata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29517013 |
ctctcgtcaaatcaattattagtagttatatatatgacttgtattatgtgcccctaaaatagaagccttcttcttttgtgtgt----actttattgaata |
29516918 |
T |
 |
| Q |
219 |
ttatctttcaaggttaacggtattaattaagtgttggtgatagctcaaactttaattatgtttctccttctctattgtttgaaccggatcctttaatttc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29516917 |
ttatctttcaaggttaacggtattaattaagtgttggtgatagctcaaactttaattatgtttctccttctctattgtttgaaccggatcctttaatttc |
29516818 |
T |
 |
| Q |
319 |
ttaaacttgttcgaccttt |
337 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
29516817 |
ttaaacttgttcgaccttt |
29516799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 35 - 100
Target Start/End: Original strand, 40103795 - 40103860
Alignment:
| Q |
35 |
actcttaggaagaaaactttgggattttagcaacaagttgatcaattcaatttcaaagtcttgatt |
100 |
Q |
| |
|
|||||||| || |||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40103795 |
actcttagcaaagaaactttgggatttcagcaacaagttgatcaattcaatttcaaaagcttgatt |
40103860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University