View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9717_low_8 (Length: 324)
Name: NF9717_low_8
Description: NF9717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9717_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 7 - 317
Target Start/End: Complemental strand, 10490723 - 10490413
Alignment:
| Q |
7 |
ccagattgctttcacttttgaaaagaattgtccattaaaaactacttttggtgattttaagtttctgttatatcttcaggcatattatgggcaaagagtc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10490723 |
ccagattgctttcacttttgaaaagaattgcccattaaaaactacttttggtgatttaaagtttctgctatatcttcaggcatattatgggcaaagagtc |
10490624 |
T |
 |
| Q |
107 |
aacattccaccatatttcaactcggctgctgctcctggtcatgctcctcacccatacatgtggggaccaccacaggtagtgctccataggttcatttatt |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10490623 |
aacattcctccatatttcaactcggctgctgctcctggtcatgctcctcacccatacatgtggggaccaccacaggtagtgctccataggttcatttatt |
10490524 |
T |
 |
| Q |
207 |
ttgttataccattgatatttctgtgtctatttctctgtgttgctgtccttgtgtacatccttgctcgaagggatgaataatttgccaacttattgtttct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10490523 |
ttgttataccattgatatttctgtgtctatttctctgtgttgctgtccttgtgtacattcttgctcgaagggatgaataatttgccaacttattgtttct |
10490424 |
T |
 |
| Q |
307 |
gtcagcctatg |
317 |
Q |
| |
|
|||||||||| |
|
|
| T |
10490423 |
ttcagcctatg |
10490413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 48263584 - 48263698
Alignment:
| Q |
70 |
tctgttatatcttcaggcatattatgggcaaagagtcaacattccaccatatttcaactcggctgctgctcctggtcatgctcctcacccatacatgtgg |
169 |
Q |
| |
|
|||| |||||||||||||||||||||| | |||||| ||| ||||| || | |||||| ||| ||| ||||||| ||||||||||||| |||||| |
|
|
| T |
48263584 |
tctgctatatcttcaggcatattatggaccaagagttgccatgccaccttactacaactcacctgtggcttctggtcacactcctcacccatatatgtgg |
48263683 |
T |
 |
| Q |
170 |
ggaccaccacaggta |
184 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
48263684 |
gggccaccacaggta |
48263698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University