View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9718_high_12 (Length: 280)
Name: NF9718_high_12
Description: NF9718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9718_high_12 |
 |  |
|
| [»] scaffold0391 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0391 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: scaffold0391
Description:
Target: scaffold0391; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 59 - 236
Target Start/End: Original strand, 5405 - 5582
Alignment:
| Q |
59 |
ctgtgtttaaaagatcacacatgtgatataaagataatgtatgagactttacactcatattcaatttaacagggagacaattctaatttgtaaaacaccg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5405 |
ctgtgtttaaaagatcacacatgtgatataaagataatgtatgagactttacactcatattcaatttaacagggagacaattctaatttgtaaaacaccg |
5504 |
T |
 |
| Q |
159 |
gatgcaacggctgtaaccagccaaaaacaagtttccacgataggaaaaatatataattcaattggtttgagttaagag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
5505 |
gatgcaacggctgtaaccagccaaaaacaagtttccacgataggaaaaatatataatttaactggtttgagttaagag |
5582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University