View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9718_low_14 (Length: 311)
Name: NF9718_low_14
Description: NF9718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9718_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 54217942 - 54218235
Alignment:
| Q |
1 |
cattgtggggtaaaacactcaccatcaatatgcgacaaggaaactttgattcatcatattaggggatcgtgaatgatggacatattcgggttgtaatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54217942 |
cattgtggggtaaaacactcaccatcaatatgcgacaaggaaactttgattcatcatattaggggatcgtgaatgatggacatattcgggttgtaatttt |
54218041 |
T |
|
| Q |
101 |
cgtcaatagttattgttgccttatctcttggggttgggtggtgtagacgttattcaaggagtggtgtggctgcattgttaagaaagtgtataaggtgggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
54218042 |
cgtcaatagttattgttgccttatctcttggggttgggtggtgtagacgttattcaaggagtggtgtggctgcattgttaagaaagtgtataaggtggat |
54218141 |
T |
|
| Q |
201 |
ttggagaatacggtgggagatgccctatctaagcagcataaggaacatgaattcagaactattgtgtcatagcctattttgatgcatggcaaag |
294 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54218142 |
ttggagaatacggtgggagatgctctatctaagcagcataaggaacatgaattcagaactattgtgtcgtagcctattttgatgcatggcaaag |
54218235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University