View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9719_high_18 (Length: 254)

Name: NF9719_high_18
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9719_high_18
NF9719_high_18
[»] chr5 (2 HSPs)
chr5 (18-126)||(23145366-23145474)
chr5 (142-244)||(23145461-23145563)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 23145366 - 23145474
Alignment:
18 caatcaaggtgtaaaagttttattttctctttaaatccgtggctgttgcatccggtggagtgtatgggagtggaggcggaactgagtggcgatttgggat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||    
23145366 caatcaaggtgtaaaagttttattttctctttaaatccgtggctgtttcatccggtggagtgtatgggagtggaggtggaactgagtggcgatttgggat 23145465  T
118 catcgtctc 126  Q
    |||||||||    
23145466 catcgtctc 23145474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 142 - 244
Target Start/End: Original strand, 23145461 - 23145563
Alignment:
142 gggatcatcgtctcttgtttcttgcttcttttgtattatgctttctgcacaggctttaggagtttttctgtatctgttttgtctctactgctatacctct 241  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
23145461 gggatcatcgtctcttgtttcctgcttcttttgtattatgctttctgcacaggctttaggagtttttctgtatctgttttctctctactgctatacctct 23145560  T
242 gtg 244  Q
    |||    
23145561 gtg 23145563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University