View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9719_high_22 (Length: 240)
Name: NF9719_high_22
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9719_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 3036387 - 3036172
Alignment:
| Q |
9 |
ttgactatagttaa-taatttatctattaattataaaagaatgttgtcgttttgttaactgcatggtgttttctttgttcttatataggtgggaagtcgt |
107 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3036387 |
ttgactatagttaaataatttatctatgaattataaaagaatgttgtcgttttgttaactgcatggtgttttctttgttcttatataggtgggaagtcgt |
3036288 |
T |
|
| Q |
108 |
tgaaggtggtgaaacaaaaacggcacgagacgttagaaaacacgtggaagacaataacggagggtcggtcaattccgttaagtagacacatgaagaagtg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3036287 |
tgaaggtggtgaaacaaaaacggcacgagacgttagaaaacacgtggaagacaataacggagggtcggtcaattccgttaagtagacacatgaagaagtg |
3036188 |
T |
|
| Q |
208 |
tgacacgtggcaaaac |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3036187 |
tgacacgtggcaaaac |
3036172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University