View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9719_high_23 (Length: 240)
Name: NF9719_high_23
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9719_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 6011910 - 6011699
Alignment:
| Q |
16 |
ataaactcagcaaacaatgcattacatacaccaaggttttgagcaaaacaccccatat---tctctcccaggttattcctgaaaattcctgcacaggctc |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6011910 |
ataaacttagcaaacaatgcattacatacaccaaggttttgagcaaaacaccccatataattctctcccaggttattcctgaaaattcctgcacaggctc |
6011811 |
T |
 |
| Q |
113 |
ctaagcctggatttcccaaagccgcgccatcagtgttacatttcacccaattaggtattggaggctgccagataacctcaacaattctaggtgctcttgg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6011810 |
ctaagcctggatttcccaaagccgcgccatcagtgttacatttcacccagttatgtattggaggcggccagataacctcaacaattctaggtgctcttgg |
6011711 |
T |
 |
| Q |
213 |
atgatgagtttc |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6011710 |
atgatgagtttc |
6011699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 224
Target Start/End: Complemental strand, 7231933 - 7231821
Alignment:
| Q |
109 |
gctcctaagcctggatttcccaaagccgcgccatcagtgttacatttcacccaattaggtattggaggctgccagataacctcaacaattctaggtgctc |
208 |
Q |
| |
|
|||||||| || |||||| |||||| | ||||||||| |||||||||| | ||| | |||||||||| ||| | || ||||||||| ||||||||| |
|
|
| T |
7231933 |
gctcctaaaccaggattttccaaagttgtgccatcagt---acatttcaccaagttatggattggaggcttccaaaatacttcaacaattataggtgctc |
7231837 |
T |
 |
| Q |
209 |
ttggatgatgagtttc |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7231836 |
ttggatgatgagtttc |
7231821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University