View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9719_high_8 (Length: 390)
Name: NF9719_high_8
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9719_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 313; Significance: 1e-176; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 5 - 371
Target Start/End: Complemental strand, 41241646 - 41241280
Alignment:
| Q |
5 |
agtcccccggagtacaaccttgacgaatacacagtcaacaacaaaaataaacaaattaacctaaacataatgggaaggacccaaaaacaaacatg----t |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41241646 |
agtcccccggagtacaaccttgacgaatacacagtcaacaacaaaaataagcaaa----cctaaacataatgggaaggacccaaaaacaaacatgcatgt |
41241551 |
T |
 |
| Q |
101 |
ttagaggccaaggtaatgtggcagccctgctgcctatctgcataaactcaaaccttcagacgtcaaggaggcataactgaacatatatcttgttatcgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41241550 |
ttagaggccaaggtaatgtggcagccctgctgcctatctgcataaactcaaaccttcagacgtcaaggaggcataactgaacatatatcttgttatcgtg |
41241451 |
T |
 |
| Q |
201 |
aaaacacaacagttcaaacccaatcaagaaatgcgacccaccgacctatcgaaactggaaccaaccggtggaaggagagggttaaacagtggtctgtgga |
300 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41241450 |
aaaacacaacagtccaaacccaatcaagaaatgcgacccaccgacctattgaaactggaaccaaccagtggaaggagagggttaaacagtggtctgtgga |
41241351 |
T |
 |
| Q |
301 |
ggatggatctcgtcgcaccaccacccttgagactacataatgcacttgtgttttggaaggcgggatttcgg |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41241350 |
ggatggatctcgtcgcaccaccacccttgaggctacataatgcacttgtgttttggaaggggggatttcgg |
41241280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 295 - 338
Target Start/End: Original strand, 41246415 - 41246458
Alignment:
| Q |
295 |
tgtggaggatggatctcgtcgcaccaccacccttgagactacat |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41246415 |
tgtggaggatggatctcgtcgcaccaccacccttgagactacat |
41246458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 263
Target Start/End: Original strand, 47940363 - 47940432
Alignment:
| Q |
194 |
tatcgtgaaaacacaacagttcaaacccaatcaagaaatgcgacccaccgacctatcgaaactggaacca |
263 |
Q |
| |
|
|||||||||||||||||| | |||| |||||| |||||||| |||| || ||||| |||||||||||||| |
|
|
| T |
47940363 |
tatcgtgaaaacacaacaatccaaatccaatctagaaatgcaacccgccaacctagcgaaactggaacca |
47940432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University