View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9719_low_31 (Length: 254)
Name: NF9719_low_31
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9719_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 23145366 - 23145474
Alignment:
| Q |
18 |
caatcaaggtgtaaaagttttattttctctttaaatccgtggctgttgcatccggtggagtgtatgggagtggaggcggaactgagtggcgatttgggat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23145366 |
caatcaaggtgtaaaagttttattttctctttaaatccgtggctgtttcatccggtggagtgtatgggagtggaggtggaactgagtggcgatttgggat |
23145465 |
T |
|
| Q |
118 |
catcgtctc |
126 |
Q |
| |
|
||||||||| |
|
|
| T |
23145466 |
catcgtctc |
23145474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 142 - 244
Target Start/End: Original strand, 23145461 - 23145563
Alignment:
| Q |
142 |
gggatcatcgtctcttgtttcttgcttcttttgtattatgctttctgcacaggctttaggagtttttctgtatctgttttgtctctactgctatacctct |
241 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23145461 |
gggatcatcgtctcttgtttcctgcttcttttgtattatgctttctgcacaggctttaggagtttttctgtatctgttttctctctactgctatacctct |
23145560 |
T |
|
| Q |
242 |
gtg |
244 |
Q |
| |
|
||| |
|
|
| T |
23145561 |
gtg |
23145563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University