View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9719_low_35 (Length: 251)
Name: NF9719_low_35
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9719_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 124 - 245
Target Start/End: Complemental strand, 39525585 - 39525464
Alignment:
| Q |
124 |
ctttgttggaaggattttatcgaccaagcgttgtcatgctttacagcataaactgtgtttcattgaaattttatcatgcggaatattggttttacatgat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39525585 |
ctttgttggaaggattttatcgaccaagcgttgtcatgctttactgcataaactgtgtttcattgaaattttatcatgcggaatattggttttacatgat |
39525486 |
T |
|
| Q |
224 |
gagttccatggtttcatctcac |
245 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39525485 |
gagttccatggtttcatctcac |
39525464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 39525740 - 39525632
Alignment:
| Q |
1 |
aatgtttttgatgtaagataaaatgaaaaaatgaatttgattattagttattttattttctaatacagttttagtccctttatgtaagattgcagataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39525740 |
aatgtttttgatgtaagataaaatgaaaaaatgaatttgattattagttattttattttctaatacagttttagtccctttatgtaagattgcagataat |
39525641 |
T |
|
| Q |
101 |
aaactgata |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
39525640 |
aaactgata |
39525632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University