View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9719_low_36 (Length: 251)
Name: NF9719_low_36
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9719_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 3036449 - 3036694
Alignment:
| Q |
1 |
ttaattttcatcaaccacaattataagacannnnnnncaaggggataaattgtttttattttattttataagaaatgaattggtgtttgtttccaaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3036449 |
ttaattttcatcaaccacaattataagacatttttttcaaggggataaattgtttttattttattttataagaaatgaattggtgtttgttgtcaaaatt |
3036548 |
T |
 |
| Q |
101 |
aatgtgtgnnnnnnntgataccttctggaccgaatttaagaggtttccggtgagggaacctagtagaaaggagaggtttatcaaccggcgagtccatcct |
200 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3036549 |
aataagtgaaaaaaatgataccttctggaccgaatttaagaggtttccggtgagtgaacctagtagaaaggagaggtttatcaaccggcgagtccatcct |
3036648 |
T |
 |
| Q |
201 |
cttcagcggaaaaattccaacgtcaatttgtttggtctctgcttct |
246 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3036649 |
cttcagtggaaaaattccaacgtcaatttgtttggtctcttcttct |
3036694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University