View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9719_low_40 (Length: 239)
Name: NF9719_low_40
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9719_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 17181407 - 17181496
Alignment:
| Q |
1 |
accaaatagtattatttctacaaaatttgtaaaataaaatcaagcaagtctttagttctagatcatttatttcttttttcaattgttatg |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17181407 |
accaaatagtattatttctacaaaatttgtaaaataaaatcaagcaaggctttagttctagatcatttatttcttttttcaattgttatg |
17181496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 125 - 196
Target Start/End: Original strand, 17181531 - 17181602
Alignment:
| Q |
125 |
gcaagcaactaaactacaatatatatgattggaatttgtgttattatgaggacatttttgaattttggttaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17181531 |
gcaagcaactaaactacaatatatatgattggaaattgtgttattatgaggacaattttgaattttggttaa |
17181602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University