View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9719_low_42 (Length: 238)
Name: NF9719_low_42
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9719_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 40409634 - 40409415
Alignment:
| Q |
1 |
aatcatatctaggtctaggtggtcgaaattggcacccccctatgcccatgtaataaacattgatcatttgattgacattgatataaagcgcgaattaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40409634 |
aatcatatctaggtctaggtggtcgaaattggcacccccccatgcccatgtaataaacattgatcatttgattgacattgatataaagcgcgaattaatt |
40409535 |
T |
|
| Q |
101 |
aagaagacagagttgatatggatacaagttgacaaatactctaatgaggttttaggagagtgaatgattttaatattatcctaatggttttatggataca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40409534 |
aagaagacagagttgatatggatacaagttgacaaatactctaatgaggttttaggagagtgaatgattttaatattatcctaatggttttatggataca |
40409435 |
T |
|
| Q |
201 |
aattgaataaaagtaagatg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40409434 |
aattgaataaaagtaagatg |
40409415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University