View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9719_low_44 (Length: 237)
Name: NF9719_low_44
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9719_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 8036796 - 8037016
Alignment:
| Q |
1 |
ctataacttaacctagttttgtagttgactatagtttatgtatgtttcgtccgatgtgtttgattcagctagcttatagaaatgtgaattatcaaaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8036796 |
ctataacttaacctagttttgtagttgactatagtttatgtatgtttcgtccgatgtgtttgattcagctagcttatagaaatgtgaattatcaaaattc |
8036895 |
T |
|
| Q |
101 |
aaaagacaaattcaaagtgacaaaagatcggaaaagaaagccggtaaccatcttgcgttcaagaaatggacttctatgtgaggtaccatttacatgctta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8036896 |
aaaagacaaattcaaagtgacaaaagatcagaaaagaaagccggtaaccatcttgcgttcaagaaatggacttctatgtgaggtaccatttacatgctta |
8036995 |
T |
|
| Q |
201 |
ttattactattaattagtatt |
221 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
8036996 |
ttattactattaattactatt |
8037016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 205
Target Start/End: Original strand, 43904873 - 43904928
Alignment:
| Q |
150 |
atcttgcgttcaagaaatggacttctatgtgaggtaccatttacatgcttattatt |
205 |
Q |
| |
|
||||||| |||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43904873 |
atcttgcattcaagaaataaacttctaattgaggtaccatttacatgcttattatt |
43904928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 205
Target Start/End: Original strand, 12349301 - 12349357
Alignment:
| Q |
149 |
catcttgcgttcaagaaatggacttctatgtgaggtaccatttacatgcttattatt |
205 |
Q |
| |
|
||||| || ||||||||||| |||||||| ||||||||| | |||||||| |||||| |
|
|
| T |
12349301 |
catctagcattcaagaaatgaacttctatttgaggtaccgtgtacatgctaattatt |
12349357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University