View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9719_low_5 (Length: 471)
Name: NF9719_low_5
Description: NF9719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9719_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 20 - 294
Target Start/End: Original strand, 24998602 - 24998876
Alignment:
| Q |
20 |
ggttgaagggcatggggaacaatgaaggtaatgataagtttctctttaatttcactgttatatgagagtaattgatgttaagcttttatgtctgatttac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24998602 |
ggttgaagggcatggggaacaatgaaggtaatgataagtttctctttaatttcactgttatatgagagtaattgatgttaagtttttatgtctgatttac |
24998701 |
T |
 |
| Q |
120 |
nnnnnnnnattgtggtttggaaatcacaattacaaccaccacacatggttacataatttcttttcttaattgcagtttacaatcacataaactggaaaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
24998702 |
ttttttttattgtggtttggaaatcacaattacaactaccacacacggttacataatttcttttctcaattgcagtttacaatcacataaaccggaaaat |
24998801 |
T |
 |
| Q |
220 |
caaatatgaaatttgatggtaatttgtgatctgtttatttgcttcaaagtttctaacttcttcttacaaactttt |
294 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24998802 |
caaatatgaaatttgatggtaatttttgatctgtttatttgcttcaaagtttctaacttcttcttacaaactttt |
24998876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University