View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9720_9 (Length: 319)
Name: NF9720_9
Description: NF9720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9720_9 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 193 - 319
Target Start/End: Complemental strand, 35444557 - 35444431
Alignment:
| Q |
193 |
tattgaataacatggtaatgcaccttatacgctctccaacctatatgtttttcgagtggattaactgcactttattttacttcgcatgatgatcggatta |
292 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35444557 |
tattaaataacatagtaatgcaccttatacgctctccaacctatatgtttttcgagtggattaactgcactttattttacttcacatgatgatcggatta |
35444458 |
T |
 |
| Q |
293 |
gctgcacgttttacttcacattatgac |
319 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35444457 |
gctgcacgttttacttcacattatgac |
35444431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 119 - 201
Target Start/End: Complemental strand, 35445750 - 35445668
Alignment:
| Q |
119 |
atcaaactacttatttgaacatttgtattgtgatttttattactgtaacatttttggagaaaattgattatgattattgaata |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35445750 |
atcaaactacttatttgaacatttgtattgtgatttttattactgtaacatttttggagaaaattgattatgattattgaata |
35445668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University