View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9720_low_5 (Length: 224)
Name: NF9720_low_5
Description: NF9720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9720_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 40514876 - 40515068
Alignment:
| Q |
16 |
agaagaagtgggtatagtacatagataagaggcaattgtaattaagagagttatcattattaggcacacaagaaataagatgaaatatgccannnnnnna |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| | |
|
|
| T |
40514876 |
agaagaagtgggtatagtacatagataagaggcaattgtaattaagagagttatcattattaggcatacaagaaataagatgaaataagccattttctta |
40514975 |
T |
|
| Q |
116 |
aactcttcatcatgaatgttcatgtctctactataattatgagatcattggttaattttgagcatgatgattttgtttatatatgctaatttc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514976 |
aactcttcatcatgaatgttcatgtctctactataattatgagatcattggttaattttgagcatgatgattttgtttatatatgctaatttc |
40515068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University