View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9721_high_5 (Length: 275)
Name: NF9721_high_5
Description: NF9721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9721_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 258
Target Start/End: Original strand, 23875490 - 23875726
Alignment:
| Q |
16 |
aaaacctataccaagcaagcaattttcaatacgccagcacccagcaggcacaccatgccagtatttaccttccttatcagtattctttatcgccgtaaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23875490 |
aaaacctataccaagcaagcaattttcaatacgccagcatccagca------ccatgccagtatttaccttccttatcagtattctttatcgccgtaaac |
23875583 |
T |
|
| Q |
116 |
tataaacagttgtttgtgaaaaggggattatctagtcataactaagaaaacacgttactaaatgtctaaatcaatcaattagtactataatttaatttta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23875584 |
tataaacagttgtttgtgaaaaggggattatctagtcataactaagaaaacacgttactaaatgtctaaatcaatcaattagtactataatttaatttta |
23875683 |
T |
|
| Q |
216 |
gtctttctccaaagaaacaagaaagagacgctgcacatgtcac |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23875684 |
gtctttctccaaagaaacaagaaagagacgctgcacatgtcac |
23875726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University