View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9721_low_14 (Length: 239)
Name: NF9721_low_14
Description: NF9721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9721_low_14 |
 | |
|
| [»] scaffold0036 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 22343 - 22559
Alignment:
| Q |
18 |
gaaactagtgatagtggtcctgctccaagaccaacaagacccgtagcttttcggcttcttttaaatgtgacatcatttcgatgtccacatccaaaaattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22343 |
gaaactagtgatagtggtcctgctccaagaccaacaagacccgtagcttttcggcttcttttaaatgtgacatcattttgatgtccacatccaaaaattg |
22442 |
T |
|
| Q |
118 |
atttaggaaatgtaacatctttttctccaaagttgatggaatcagtacccaaatctccaatggtgtaagatttatcaccataagtgtaaaaatactcaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22443 |
atttaggaaatgtaacatctttttctccaaagttgatggaatcagtacccaaatctccaatggtgtaagatttatcaccataagtgtaaaaatactcaca |
22542 |
T |
|
| Q |
218 |
cttctctgcttctccac |
234 |
Q |
| |
|
||| | || |||||||| |
|
|
| T |
22543 |
cttatttgattctccac |
22559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 89 - 145
Target Start/End: Original strand, 14376 - 14432
Alignment:
| Q |
89 |
atcatttcgatgtccacatccaaaaattgatttaggaaatgtaacatctttttctcc |
145 |
Q |
| |
|
||||||| || ||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
14376 |
atcattttgaagtccacatccaaaaactgattttggaaatgtaacatctttttctcc |
14432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University