View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9721_low_4 (Length: 340)
Name: NF9721_low_4
Description: NF9721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9721_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 38 - 326
Target Start/End: Complemental strand, 41241915 - 41241627
Alignment:
| Q |
38 |
atcaatttgcgcttttattttggaacggtttgaatttaaacactgattgaactctctttcgaggatctcacacttgatagtaattattacatgggaaggg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41241915 |
atcaatttgcgcttttattttggaacggtttgaatttaaacaccgacagaactctctttcgaggatctcacacttgatagtaattattacatgggaaggg |
41241816 |
T |
|
| Q |
138 |
tcataagaattgagaagatgatgatgaggatatcaaacgagcctgatcaatcacaatgaccaatatagatattaaggcgacacctatgtggaatatgaac |
237 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41241815 |
tcataagaattgagaagatgatgaggaggatatcaaacaagcctgatcaatcacaatgaccaatatagatattaaggcgacacctatgtagaatatgaac |
41241716 |
T |
|
| Q |
238 |
ccttgaaacttgaactgggaacaacatagatccaagtatcatgagcatgaatcaggtacctacctattaagtcccccggagtacaacct |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
41241715 |
ccttgaaacttgaactgggaacaacatagatccaagtatcatgagcatgaatcaggtacgtacctattcagtcccccggagtacaacct |
41241627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 249
Target Start/End: Original strand, 41246003 - 41246072
Alignment:
| Q |
180 |
ctgatcaatcacaatgaccaatatagatattaaggcgacacctatgtggaatatgaacccttgaaacttg |
249 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||| || ||||| || ||||||||||||||||| |
|
|
| T |
41246003 |
ctgagcaatcacaatgaccaatagaggtattaaggcgacgccgatgtgaaacctgaacccttgaaacttg |
41246072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 38 - 80
Target Start/End: Original strand, 35672226 - 35672268
Alignment:
| Q |
38 |
atcaatttgcgcttttattttggaacggtttgaatttaaacac |
80 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
35672226 |
atcaatttgcgattttattttggatcggtttgaatttgaacac |
35672268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 80
Target Start/End: Complemental strand, 41074868 - 41074831
Alignment:
| Q |
43 |
tttgcgcttttattttggaacggtttgaatttaaacac |
80 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
41074868 |
tttgcggttttattttggaacggtttggatttaaacac |
41074831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University