View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9721_low_6 (Length: 296)
Name: NF9721_low_6
Description: NF9721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9721_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 19 - 288
Target Start/End: Original strand, 19805463 - 19805732
Alignment:
| Q |
19 |
ctccccacactctcacaacctaactctcaactctttttatctcacgatcataagttgttctaaattcttggagactgaggctgactgcttcgacaaatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19805463 |
ctccccacactctcacaacctaactctcaactctttttatctcacgatcataagttgttctaaattcttggagactgaggctgactgcttcgacaaatgg |
19805562 |
T |
 |
| Q |
119 |
gtcgaagcagcaaaacaacgtcatgtcaaggatctccagctacactttttaccttcgatacatgcccctttagcgcctacagtcttctgctgcaaaacac |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
19805563 |
gtcgaagcagcaaaacaacgtcgtgtcaaggatctccagctacactttttaccttcgatacacgtccctttagcacctactgtcttctgctgcaaaacac |
19805662 |
T |
 |
| Q |
219 |
ttgtggttttgggtttgacgggaatacatataggcactttgtttcatggttatattgatcttcctttgct |
288 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
19805663 |
ttgtggttctaggtttgacgggaatacatataggcactttgtttcatggttctgttgatcttcctttgct |
19805732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University