View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9722_high_2 (Length: 490)
Name: NF9722_high_2
Description: NF9722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9722_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 114 - 475
Target Start/End: Complemental strand, 46901506 - 46901145
Alignment:
| Q |
114 |
gcccacgttttcattgagcctagcagccgcagcaacagaagcagctacaccaccaggagtagcagtagcatcaggattattcctcatctcagcactagcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901506 |
gcccacgttttcattgagcctagcagccgcagcaacagaagcagctacaccaccaggagtagcagtagcatcaggattattcctcatctcagcactagcc |
46901407 |
T |
 |
| Q |
214 |
accccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgttgctccggtcagaacatctcccatcttaatcttctcctcctcacgtt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901406 |
accccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgttgctccggtcagaacatctcccatcttaatcttctcctcctcacgtt |
46901307 |
T |
 |
| Q |
314 |
gacactcagcattgaaagctgctgcagattgagccattgaagccaaacctcccggtgttataatattactccccgtagctctcacctccgccgcttgtat |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901306 |
gacactcagcattgaaagctgctgcagattgagccattgaagccaaacctcccggtgttataacattactccccgtagctctcacctccgccgcttgtat |
46901207 |
T |
 |
| Q |
414 |
cgcagaggcgtcactctgttccaccggcttgtcacccaccgtgtgggccgtcgcctctagtg |
475 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46901206 |
cgcagaggcgtcactctgttccaccggcttgtcgcccaccgtgtgggccgtcgcctctagtg |
46901145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University