View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9722_high_6 (Length: 226)
Name: NF9722_high_6
Description: NF9722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9722_high_6 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 16205655 - 16205424
Alignment:
| Q |
1 |
aattaaggacacaatcacaaagcatggtcaccatgatgatcatgaacatggtcatggtcatg------atcaatatcactatgaaaatcaacatatccct |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16205655 |
aattaaggacacaatcacaaagcatggtcaccatgatgatcatgaacatggtcatggtcatggtcatgatcaatatcactatgaaaatcaacatatccct |
16205556 |
T |
 |
| Q |
95 |
aatgatcatgacttggatgaggaagatgaagtggatgaagacccagaaatccatggagcaccaagtaannnnnnnctctttcatttcttcttgcacagaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16205555 |
gatgatcatgacttggatgaggaagatgaagtggatgaagacccagaaatccatggagcaccaagtaatttttttctctttcatttcttcttgcacagaa |
16205456 |
T |
 |
| Q |
195 |
gaaattatctagagaatatcaactacattttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16205455 |
gaaattatctagagaatatcaactacattttt |
16205424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University