View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9722_low_14 (Length: 220)
Name: NF9722_low_14
Description: NF9722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9722_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 8092459 - 8092272
Alignment:
| Q |
14 |
cataggaccctttaaccatcaagtattcttttcttgaaaactttggcaaacgtttcccaactttgttaaccatcacagccggatacgtgcctgcgtataa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
8092459 |
cataggaccctttaaccatcaagtattcctttcttgaaaactttggcaaacgtttcccaactttgttaaccatcacagcaggatatgtgcctgcgtataa |
8092360 |
T |
|
| Q |
114 |
cggttccatgaaccttgcattacacaaaattacgcgttttagaggtcttagaaacggcatcttaactgcgattgtggctgcatttgtctat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
8092359 |
cggttccatgaaccttgcattacacaaaattacgcgttttagaggtcttagaaa---catcttaactgcgattgcggctgcatttgtctat |
8092272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University