View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9722_low_16 (Length: 206)
Name: NF9722_low_16
Description: NF9722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9722_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 24 - 185
Target Start/End: Complemental strand, 37632977 - 37632817
Alignment:
| Q |
24 |
atatgtgtggtccacgatcaacctttttctggttacatccattagaaaattattcaaaatgttaacaattggctaatataaagttttacaagtagaacca |
123 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
37632977 |
atatgtgtggtccacgagccacctttttctgattacatccattagaaa-ttattcaaaatgttaacaattggctaatataaatttttacaagtagaatca |
37632879 |
T |
|
| Q |
124 |
gaagttcttgattttcattgttgcaacctctaagacaatagacggatcggtgtcaatttgaa |
185 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
37632878 |
gaagttcttgattttcgttgttgcaacatctaagacaatagacagatcgctgtcaatttgaa |
37632817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University