View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9722_low_16 (Length: 206)

Name: NF9722_low_16
Description: NF9722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9722_low_16
NF9722_low_16
[»] chr2 (1 HSPs)
chr2 (24-185)||(37632817-37632977)


Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 24 - 185
Target Start/End: Complemental strand, 37632977 - 37632817
Alignment:
24 atatgtgtggtccacgatcaacctttttctggttacatccattagaaaattattcaaaatgttaacaattggctaatataaagttttacaagtagaacca 123  Q
    ||||||||||||||||| | ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||    
37632977 atatgtgtggtccacgagccacctttttctgattacatccattagaaa-ttattcaaaatgttaacaattggctaatataaatttttacaagtagaatca 37632879  T
124 gaagttcttgattttcattgttgcaacctctaagacaatagacggatcggtgtcaatttgaa 185  Q
    |||||||||||||||| |||||||||| ||||||||||||||| ||||| ||||||||||||    
37632878 gaagttcttgattttcgttgttgcaacatctaagacaatagacagatcgctgtcaatttgaa 37632817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University