View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9722_low_8 (Length: 246)
Name: NF9722_low_8
Description: NF9722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9722_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 33163573 - 33163805
Alignment:
| Q |
1 |
gtggttattttgcaggtactttctgaaggctggatatgctgttatctttttgcaccgtaggtaaatttcttatcatgtaatttatccttttctcacgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33163573 |
gtggttattttgcaggtactttctgaaggctggatatgctgttatctttttgcaccgtaggtaaatttcttatcatgtaatttatccttttctcatgttt |
33163672 |
T |
|
| Q |
101 |
gatgtgttgatttaccaatgaataattatgcagggggagttaccagccattttgcagatccattcctgatgatcccttacttgaatgcttcgagccaacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33163673 |
gatgtgttgatttaccaatgaataattatgcagggggagttaccagccattttgcagatccattcctgatgatcccttacttgaatgcttcgagctgacc |
33163772 |
T |
|
| Q |
201 |
aacgatttaaatattcaaggttttccatctctg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
33163773 |
aacgatttaaatattcaaggttttccatttctg |
33163805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 99 - 225
Target Start/End: Complemental strand, 46162427 - 46162302
Alignment:
| Q |
99 |
ttgatgtgttgatttaccaatgaataattatgcagggggagttaccagccattttgcagatccattcctgatgatcccttacttgaatgcttcgagccaa |
198 |
Q |
| |
|
|||||||||| ||| ||||||||||| ||||||||||| |||| ||||||||||||||||||| |||| || |||||||||||||||||||||||||| | |
|
|
| T |
46162427 |
ttgatgtgttaatt-accaatgaatatttatgcaggggaagtttccagccattttgcagatcccttcccgaggatcccttacttgaatgcttcgagccca |
46162329 |
T |
|
| Q |
199 |
ccaacgatttaaatattcaaggttttc |
225 |
Q |
| |
|
||||||| ||||| ||||||||||||| |
|
|
| T |
46162328 |
ccaacgacttaaacattcaaggttttc |
46162302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 46162557 - 46162488
Alignment:
| Q |
1 |
gtggttattttgcaggtactttctgaaggctggatatgctgttatctttttgcaccgtaggtaaatttct |
70 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
46162557 |
gtggttactttgcaggtactttctgaaggctggatatgctgttatctttctgtaccggaggtaaatttct |
46162488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University