View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9723_high_13 (Length: 298)
Name: NF9723_high_13
Description: NF9723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9723_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 31412333 - 31412603
Alignment:
| Q |
1 |
tatagtagaggttattgtttcttttttaaactaaggtatcacatccttacatagattaatcattcaaagtacgtagtcgagatctatttaataaattaat |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31412333 |
tatagtagaggttattgtt-cttttttaaactaaggtatcagacccttacatagattaatcattcaaagta----gtcgagatctatttaataaattaat |
31412427 |
T |
 |
| Q |
101 |
ctccttgatccttggtatttttacatcaaannnnnnnnnnnnngagagataaacttttacgacctaactaggaattgtcgttaaagaatatattttagca |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31412428 |
ctccttgatccttg-tatttttacatcaattttttttttta---agagataaacttttatgacctaactaggaattgtcgttaaagaatatattttagca |
31412523 |
T |
 |
| Q |
201 |
ctttttggcgcttgatatactcgtatgcttaattacttattaatctattttgggttaaggtaaactttgtaagtagtttt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31412524 |
ctttttggcgcttgatatactcgtatgctgaattacttattaatctattttgggttaaggtaaactttgtaagtagtttt |
31412603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 31413868 - 31413832
Alignment:
| Q |
23 |
tttttaaactaaggtatcacatccttacatagattaa |
59 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31413868 |
tttttaaactaaggtatcagatccttacatagattaa |
31413832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University