View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9723_high_17 (Length: 242)
Name: NF9723_high_17
Description: NF9723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9723_high_17 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0202 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 21641858 - 21642067
Alignment:
| Q |
16 |
ggatggaatgttgaatgactatgttgctggaaagaccaaagtgaaacctcataaaacagccacaacaaaatttgttgcagcactaacatgtcttcaattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21641858 |
ggatggaatgttgaatgactatgttgctggaaagaccaaagtgaaacctcataaaacagccacaacaaaatttgttgcagcactaacatgtcttcaattt |
21641957 |
T |
 |
| Q |
116 |
ttctttgcagtctatgcaacatttttattgtactacatgggtccttcaattgatttaagaaccaaaccagatttctcaagaattgcacaacaatggaaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21641958 |
ttctttgcagtctatgcaacatttttattgtactacatgggtccttcaattgatttaagaaccaaaccagatttctcaagaattgcacaacaatggaaaa |
21642057 |
T |
 |
| Q |
216 |
gtctcatgat |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
21642058 |
gtctcatgat |
21642067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 91 - 147
Target Start/End: Complemental strand, 172687 - 172631
Alignment:
| Q |
91 |
tgcagcactaacatgtcttcaatttttctttgcagtctatgcaacatttttattgta |
147 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
172687 |
tgcagccctaacatgtcttcaatttttctttgcagtttatgcaacatttttattgta |
172631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0202
Description:
Target: scaffold0202; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 82 - 147
Target Start/End: Complemental strand, 18609 - 18544
Alignment:
| Q |
82 |
aaaatttgttgcagcactaacatgtcttcaatttttctttgcagtctatgcaacatttttattgta |
147 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
18609 |
aaaattttatgcagccctaacatgtcttcaatttttctttgcagtttatgcaacatttttgttgta |
18544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University